CardioGenomics
overview researchers projects data publications events links
What's New
Candidate Genes
How to Cite Us
FAQ's
Other PGA's
Contact Us


this site
all PGA's
PGA Gene
Sign In
View other projects: 1   2   3   4   5  
Downloadable Datasets Animal Models Project 1 Home

Quantitative PCR Database

Gene Name Number of Primer Sequences
Human Mouse Rat Other
ABCD4: ATP-binding cassette, sub-family D, member 4 - 1 - -
Abl1: v-abl Abelson murine leukemia oncogene 1 - - - 1
Ace: Angiotensin 1 converting enzyme 1 - - 1 -
ACTa1: Actin, alpha 1, skeletal muscle - 1 - -
AEBP1: AE binding protein 1 1 - - -
Agt: Angiotensinogen - - 1 -
Agtr1a: Angiotensin II receptor, type 1 - - 1 -
Agtr2: Angiotensin II receptor, type 2 - - 1 -
AGTRL1: Angiotensin II receptor-like 1 1 - - -
APLN: Apelin 1 - - -
BMP4: Bone morphogenetic protein 4 - 1 - -
Clu: Clusterin - 1 - -
Col3a1: Procollagen, type III, alpha 1 - 1 - -
c-fos: c-fos oncogene - - 1 -
DPYSL4: Dihydropyrimidinase-like 4 1 - - -
DSCR1: Down syndrome critical region gene 1 1 - - -
ECE1: Endothelin converting enzyme 1 - - - 1
Edn1: Endothelin 1 - - - 1
Ednra: Endothelin receptor type A - - - 1
Ednrb: Endothelin receptor type B - - - 1
Fhl1: Four and a half LIM domains 1 - 1 - -
Fhl2: Four and a half LIM domains 2 - 2 - -
Fhl3: Four and a half LIM domains 3 - 1 - -
Gapd: Glyceraldehyde-3-phosphate dehydrogenase - 1 1 -
GATA4: GATA binding protein 4 - 1 - -
GATA6: GATA binding protein 6 - 1 - -
Mef2a: Myocyte enhancer factor 2A - 1 1 -
Mef2b: Myocyte enhancer factor 2B - 1 - -
Mef2c: Myocyte enhancer factor 2C - 2 1 -
Mef2d: Myocyte enhancer factor 2D - 1 - -
Myh6: Myosin, heavy polypeptide 6, cardiac muscle, alpha - 2 1 -
Myh7: Myosin, heavy polypeptide 7, cardiac muscle, beta - 2 1 -
Myl4: Myosin, light polypeptide 4, alkali; atrial, embryonic - 1 - -
Myl7: Myosin, light polypeptide 7, regulatory - 1 - -
NKx2-5: NK2 transcription factor related, locus 5 - 1 - -
Nppa: Natriuretic peptide precursor type A - 2 - -
Nppb: Natriuretic peptide precursor type B - 2 - -
OXCT: 3-oxoacid CoA transferase 1 - - -
TBX5: T-box 5 1 - - -
TGFb3: Transforming growth factor, beta 3 - - 1 -

Abcd4 ATP-binding cassette, sub-family D (ALD), member 4
GenBank/Locuslink ID 19300
Species Mm
Primer 1: Forward sequence 5'- CCTTGAGAAGTTCACTCCTGGG -3'
Primer 2: Reverse sequence 5'- TCCGCTGCTCAGATGAACC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Abl1 v-abl Abelson murine leukemia oncogene 1
Alias Abelson murine leukemia oncogene, c-Abl
Species Cl
Primer 1: Forward sequence 5'- CAGTGAAAATGACCCCAACCTT -3'
Primer 2: Reverse sequence 5'- TGCTGAGGGTATTGTCCCCA -3'
Probe Sequence 5'- CGTTGCACTGTACGATTTTGTGGCCA -3'
Product Size 71
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Sophie Motte
Institution Free University of Brussels, Brussels B-1070, Belgium
PubMed ID 14613913
Citation Am J Physiol Heart Circ Physiol 285: H2482:H2491, 2003;10.1152/ajpheart.00419.2003.
Ace Angiotensin 1 converting enzyme 1
GenBank/Locuslink ID 24310
Species Rn
Primer 1: Forward sequence 5'- CTGCCTCCCAACGAGTTAGAA -3'
Primer 2: Reverse sequence 5'- CGGGACGTGGCCATTATATT -3'
Probe Sequence 5'- AAATGGCACTTGTCTGTCACTGGAGCC -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Yoshiro Naito
Institution Hyogo College of Medicine, Nishinomiya, Japan
PubMed ID 12468565
Citation Hypertension. 2002 Dec;40(6):827-33
ACTa1 actin, alpha 1, skeletal muscle
GenBank/Locuslink ID 11459
Species Mm
Primer 1: Forward sequence 5'- TATGTGGCTATCCAGGCGGTG -3'
Primer 2: Reverse sequence 5'- CCCAGAATCCAACACGATGC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
AEBP1 adipocyte enhancer binding protein 1 precursor
Alias AE-binding protein 1, aortic carboxypeptidase-like protein
GenBank/Locuslink ID AF053944/165
Species Hs
Primer 1: Forward sequence 5'- CATCACCCAGGGCAGAGACT -3'
Primer 2: Reverse sequence 5'- TTGCTGAAGCCCACGAAGA -3'
Probe Sequence 5'- AGCATCCATGACGATTTTGTGACCACC -3'
Product Size 69
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
Agt Angiotensinogen
Alias Ang
GenBank/Locuslink ID 24179
Species Rn
Primer 1: Forward sequence 5'- AGCACGGACAGCACCCTATT -3'
Primer 2: Reverse sequence 5'- AGAACTCATGGAGCCCAGTCA -3'
Probe Sequence 5'- TCAACACCTACGTTCACTTCCAAGGGAAGA -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Yoshiro Naito
Institution Hyogo College of Medicine, Nishinomiya, Japan
PubMed ID 12468565
Citation Hypertension. 2002 Dec;40(6):827-33
Agtr1a Angiotensin II receptor, type 1
Alias Angiotensin receptor 1a, AT1A
GenBank/Locuslink ID 24180
Species Rn
Primer 1: Forward sequence 5'- TATCACAGTGTGCGCGTTTCA -3'
Primer 2: Reverse sequence 5'- TGGTAAGGCCCAGCCCTAT -3'
Probe Sequence 5'- TGAGTCTCGGAATTCGACGCTCCC -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Yoshiro Naito
Institution Hyogo College of Medicine, Nishinomiya, Japan
PubMed ID 12468565
Citation Hypertension. 2002 Dec;40(6):827-33
Agtr2 Angiotensin II receptor, type 2
Alias Angiotensin receptor 2, AT2R
GenBank/Locuslink ID 24182
Species Rn
Primer 1: Forward sequence 5'- CCTTCCTGTATTGTTTCGTTGGA -3'
Primer 2: Reverse sequence 5'- CGGCAAGACATAGTCTCTCTCTTG -3'
Probe Sequence 5'- ACCGCTTCCAACAGAAGCTCCGTAGTGT -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Yoshiro Naito
Institution Hyogo College of Medicine, Nishinomiya, Japan
PubMed ID 12468565
Citation Hypertension. 2002 Dec;40(6):827-33
AGTRL1 Angiotensin II receptor-like 1
Alias APJ
GenBank/Locuslink ID 187
Species Hs
Primer 1: Forward sequence 5'- AGCATCATCGTGGTGCTGGT -3'
Primer 2: Reverse sequence 5'- TGTACAGCGTCTTCACCAGGTG -3'
Probe Sequence 5'- TGACCTTTGCCCTGTGCTGGATGC -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Gabor Foldes
Institution Semmelweis University, Budapest, Hungary
PubMed ID 12914775
Citation Biochem Biophys Res Commun. 2003 Aug 29;308(3):480-5
APLN Apelin
GenBank/Locuslink ID 8862
Species Hs
Primer 1: Forward sequence 5'- GATGCCGCTTCCCGATG -3'
Primer 2: Reverse sequence 5'- ATTCCTTGACCCTCTGGGCT -3'
Probe Sequence 5'- ATGGGCTGGAAGACGGCAATGTCC -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Gabor Foldes
Institution Semmelweis University, Budapest, Hungary
PubMed ID 12914775
Citation Biochem Biophys Res Commun. 2003 Aug 29;308(3):480-5
Bmp bone morphogenetic protein 4
Alias Bmp2b,Bmp2b1
GenBank/Locuslink ID 12159
Species Mm
Primer 1: Forward sequence 5'- AGGGAACCGGGCTTGAGTA -3'
Primer 2: Reverse sequence 5'- CTCCAGATGTTCTTCGTGATGG -3'
Probe Sequence 5'- CAGCCGAGCCAACACTGTGAGGAGTT -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Clu Clusterin
Alias Apolipoprotein J, ApoJ
GenBank/Locuslink ID 12759
Species Mm
Primer 1: Forward sequence 5'- GTCTCCACCGTGACCACCC -3'
Primer 2: Reverse sequence 5'- CTGGTAACACCACTGTGATGGG -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Col3a1 Procollagen, type III, alpha 1
GenBank/Locuslink ID X52046/ 12825
Species Mm
Primer 1: Forward sequence 5'- AAAACCCTGCTCGGAACTG -3'
Primer 2: Reverse sequence 5'- CTTGCAGCCTTGGTTAGGAT -3'
Probe Sequence 5'- AGACCTAAAATTCTGCCACCCCGAACTC -3'
Product Size 92
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Vinciane Gaussin
Institution University of Medicine and Dentistry of New Jersey and New Jersey Medical School
PubMed ID 14623810
Citation Circulation. 2003 Dec 9;108(23):2926-33
c-fos c-fos oncogene
Genbank/Locuslink ID X06769/ 314322
Species Rn
Primer 1: Forward sequence 5'- CCATTCCCCAGCCGAC -3'
Primer 2: Reverse sequence 5'- ACAGGACTTTTGAGCAGATC -3'
Probe Sequence 5'- TCCAGCATGGGCTCTCCTGTCA -3'
Product Size 68
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Christophe Depre
Institution University of Texas Houston Medical School
PubMed ID 9809550
Citation NATURE MEDICINE : Vol.4 : No.11 : Nov.1998: 1269-1275
DPYSL4 dihydropyrimidinase-like 4
Alias ULIP4
GenBank/Locuslink ID Y10976/10570
Species Hs
Primer 1: Forward sequence 5'- TGGTCAAGGAGAAGGGTGTGA -3'
Primer 2: Reverse sequence 5'- TGGCACCGGTCCTTGTATG -3'
Probe Sequence 5'- CCTTCCTGGTCTTCATG -3'
Product Size 61
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
DSCR1 Down syndrome critical region gene 1
Alias MCIP1
GenBank ID U85267
Species Hs
Primer 1: Forward sequence 5'- CCTGTGTGGCAAACAGTGATATC -3'
Primer 2: Reverse sequence 5'- GTCATACGTCCTAAAGAGGGACTCA -3'
Probe Sequence 5'- CAGCGAAAGTGAAACCAGGGCCAAAT -3'
Product Size 77
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
ECE1 Endothelin converting enzyme 1
Species Cl
Primer 1: Forward sequence 5'- TGGGGGACCTTCAGCAACCT -3'
Primer 2: Reverse sequence 5'- GGGTGTCCTGGAGTTGTCCTTG -3'
Probe Sequence 5'- TCATCACGTGCGTGCATGACCGAGACC -3'
Product Size 235
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Sophie Motte
Institution Free University of Brussels, Brussels B-1070, Belgium
PubMed ID 14613913
Citation Am J Physiol Heart Circ Physiol 285: H2482:H2491, 2003;10.1152/ajpheart.00419.2003.
Edn1 Endothelin 1
Genbank/Locuslink ID S56805
Species Cl
Primer 1: Forward sequence 5'- TCCTGCTCTTCCCTGATGGA -3'
Primer 2: Reverse sequence 5'- TGCTCAGGAGTGTTGACCCA -3'
Probe Sequence 5'- AAAGAGTGTGTCTACTTCTGCCACCTTGACATCA -3'
Product Size 77
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Sophie Motte
Institution Free University of Brussels, Brussels B-1070, Belgium
PubMed ID 14613913
Citation Am J Physiol Heart Circ Physiol 285: H2482:H2491, 2003;10.1152/ajpheart.00419.2003.
Ednra Endothelin receptor type A
Alias Eta
GenBank ID S57498
Species Cl
Primer 1: Forward sequence 5'- GAGAATTGCACTCAGTGAACACCT -3'
Primer 2: Reverse sequence 5'- GCAAAAATTACAACCAAGCAGAAA -3'
Probe Sequence 5'- AAACAGCGTCGAGAAGTGGCAAAAACAG -3'
Product Size 80
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Sophie Motte
Institution Free University of Brussels, Brussels B-1070, Belgium
PubMed ID 14613913
Citation Am J Physiol Heart Circ Physiol 285: H2482:H2491, 2003;10.1152/ajpheart.00419.2003.
Ednrb Endothelin receptor type B
Alias Etb
GenBank ID S57283
Species Cl
Primer 1: Forward sequence 5'- CTTTTGCCTGGTCCTTGTCTTT -3'
Primer 2: Reverse sequence 5'- TGAGCTTCAAAATCCTGCTGAG -3'
Probe Sequence 5'- CCCTGTGCTGGCTTCCCCTTCA -3'
Product Size 68
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Sophie Motte
Institution Free University of Brussels, Brussels B-1070, Belgium
PubMed ID 14613913
Citation Am J Physiol Heart Circ Physiol 285: H2482:H2491, 2003;10.1152/ajpheart.00419.2003.
Fhl1 Four and a half LIM domains 1
GenBank/Locuslink ID U77039/ 14199
Species Mm
Primer 1: Forward sequence 5'- CCGTCACTGCTGCCTGA -3'
Primer 2: Reverse sequence 5'- ATGCACCTCCTTGGCATCA -3'
Probe Sequence 5'- TGCTTTGACAAGTTCTGCGCCAAC -3'
Product Size 94
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Vinciane Gaussin
Institution University of Medicine and Dentistry of New Jersey and New Jersey Medical School
PubMed ID 14623810
Citation Circulation. 2003 Dec 9;108(23):2926-33
Fhl2 Four and a half LIM domains 2
Alias SLIM3
GenBank/Locuslink ID AF114381/ 14200
Species Mm
Primer 1: Forward sequence 5'- GCCTGCTTTGAGGAACTCTATG -3'
Primer 2: Reverse sequence 5'- GCCGATCCTTGTAGGACAAG -3'
Probe Sequence 5'- TACCTGTGAGGAGTGTGGAACACCCA -3'
Product Size 91
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Vinciane Gaussin
Institution University of Medicine and Dentistry of New Jersey and New Jersey Medical School
PubMed ID 14623810
Citation Circulation. 2003 Dec 9;108(23):2926-33
Fhl2 Four and a half LIM domains 2
Alias SLIM3
GenBank/Locuslink ID AF114381/ 14200
Species Mm
Primer 1: Forward sequence 5'- AAGGAGAATCAGAACTTCTGCGTG -3'
Primer 2: Reverse sequence 5'- CGGTAAGTAACACCTCCTGTGGT -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Fhl3 Four and a half LIM domains 3
GenBank/Locuslink ID AF114382/ 14201
Species Mm
Primer 1: Forward sequence 5'- GACAACACCTTCGCCAACAC -3'
Primer 2: Reverse sequence 5'- GGAAGTGGCGGTCCTCATA -3'
Probe Sequence 5'- TGCTGAGTGCCAGCAGCTCATTGG -3'
Product Size 88
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Vinciane Gaussin
Institution University of Medicine and Dentistry of New Jersey and New Jersey Medical School
PubMed ID 14623810
Citation Circulation. 2003 Dec 9;108(23):2926-33
Gapd Glyceraldehyde-3-phosphate dehydrogenase
Alias GAPDH
GenBank/Locuslink ID 14433
Species Mm
Primer 1: Forward sequence 5'- TGCACCACCAACTGCTTAG -3'
Primer 2: Reverse sequence 5'- GGATGCAGGGAT GATGTTC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Gapd Glyceraldehyde-3-phosphate dehydrogenase
Alias GAPDH
GenBank/Locuslink ID 24383
Species Rn
Primer 1: Forward sequence 5'- TGACAACTCCCTCAAGATTGTCA -3'
Primer 2: Reverse sequence 5'- GGCATGGACTGTGGTCATGA -3'
Probe Sequence 5'- TGCATCCTGCACCACCAACTGCTTAG -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Yoshiro Naito
Institution Hyogo College of Medicine, Nishinomiya, Japan
PubMed ID 12468565
Citation Hypertension. 2002 Dec;40(6):827-33
Gata4 GATA binding protein 4
GenBank/Locuslink ID 14463
Species Mm
Primer 1: Forward sequence 5'- CCCTGGAAGACACCCCAAT -3'
Primer 2: Reverse sequence 5'- TGGACATGGCCCCACAAt -3'
Probe Sequence 5'- TCGATATGTTTGATGACTTCTCAGAAGGCAGAG -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Gata6 GATA binding protein 6
GenBank/Locuslink ID 14465
Species Mm
Primer 1: Forward sequence 5'- AGATGAATGGCCTCAGCAGG -3'
Primer 2: Reverse sequence 5'- CAAGCCGCCGTGATGAA -3'
Probe Sequence 5'- CTCATCAAGCCACAGAAGCGCGTG -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Mef2a Myocyte enhancer factor 2a
GenBank/Locuslink ID 17258
Species Mm
Primer 1: Forward sequence 5'- AAGTACCGGCAGTGCAAGTGG -3'
Primer 2: Reverse sequence 5'- CCCTTGAGTTTACAAATCCATTCC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Mef2a Myocyte enhancer factor 2a
GenBank/Locuslink ID U30823/ 17258
Species Rn
Primer 1: Forward sequence 5'- CATTCCCCCATCAAGCAAG -3'
Primer 2: Reverse sequence 5'- CTGCTTATCCTTTGGGCATTG -3'
Probe Sequence 5'- CCCACTTTCGGAGGAAGAGGAATTGG -3'
Product Size 81
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Christophe Depre
Institution University of Texas Houston Medical School
PubMed ID 9809550
Citation NATURE MEDICINE : Vol.4 : No.11 : Nov.1998: 1269-1275
Mef2b Myocyte enhancer factor 2B
GenBank/Locuslink ID 17259
Species Mm
Primer 1: Forward sequence 5'- AACGCCTCTTCCAGTATGCG -3'
Primer 2: Reverse sequence 5'- CTCCTCTTAAGTGTCTGAAGGATATCC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Mef2c Myocyte enhancer factor 2C
GenBank/Locuslink ID 17260
Species Mm
Primer 1: Forward sequence 5'- TCAAGTACACCGAGTACAACGAGC -3'
Primer 2: Reverse sequence 5'- TCTTTCTTGTTCAATGCCTCCA -3'
Probe Sequence 5'- CACGAGAGCCGGACAAACTCAGACATT -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Mef2c Myocyte enhancer factor 2C
GenBank/Locuslink ID 17260
Species Mm
Primer 1: Forward sequence 5'- GATGCCATCAGTGAATCAAAGG -3'
Primer 2: Reverse sequence 5'- GTTGAAATGGCTGATGGATATCC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Mef2c Myocyte enhancer factor 2C
GenBank/Locuslink ID 17261
Species Rn
Primer 1: Forward sequence 5'- CGCGTTCTTATCCCACCTG -3'
Primer 2: Reverse sequence 5'- GCCAATGACTGAGCCGACT -3'
Probe Sequence 5'- ACACGATGCCATCAGTGAATCAAAGGA -3'
Product Size 86
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Christophe Depre
Institution University of Texas Houston Medical School
PubMed ID 9809550
Citation NATURE MEDICINE : Vol.4 : No.11 : Nov.1998: 1269-1275
Mef2d Myocyte enhancer factor 2D
GenBank/Locuslink ID 17261
Species Mm
Primer 1: Forward sequence 5'- CCCACTGCCTACAACACAGATTACC -3'
Primer 2: Reverse sequence 5'- GCGGTGACATTGCCTAGTGC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Myh6 Myosin, heavy polypeptide 6, cardiac muscle, alpha
Alias alpha-myosin heavy chain, alpha-MHC
GenBank/Locuslink ID M76601/ 17888
Species Mm
Primer 1: Forward sequence 5'- CCACTGTGGTGCCTCGTTC -3'
Primer 2: Reverse sequence 5'- GCGTCCGTCATTCTGTCACTC -3'
Spans Intron N
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Myh6 Myosin, heavy polypeptide 6, cardiac muscle, alpha
Alias alpha-myosin heavy chain, alpha-MHC
GenBank/Locuslink ID M76601/ 17888
Species Mm
Primer 1: Forward sequence 5'- TGTGGTGCCTCGTTCCA -3'
Primer 2: Reverse sequence 5'- TTTCGGAGGTACTGGGCTG -3'
Probe Sequence 5'- ACGCCCAGATGGCTGACTTCGG -3'
Product Size 128
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Vinciane Gaussin
Institution University of Medicine and Dentistry of New Jersey and New Jersey Medical School
PubMed ID 14623810
Citation Circulation. 2003 Dec 9;108(23):2926-33
Myh6 myosin, heavy polypeptide 6, cardiac muscle, alpha
Alias alpha-myosin heavy chain, alpha-MHC
GenBank/Locuslink ID X15938/ 29556
Species Rn
Primer 1: Forward sequence 5'- TGTGAAAAGATTAACCGGAGTTTAAG -3'
Primer 2: Reverse sequence 5'- TCTGACTTGCGGAGGTATCG -3'
Probe Sequence 5'- CCIAAGTCAGCCATCTGGGCACT -3'
Product Size 91
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Christophe Depre
Institution University of Texas Houston Medical School
PubMed ID 9809550
Citation NATURE MEDICINE : Vol.4 : No.11 : Nov.1998: 1269-1275
Myh7 myosin, heavy polypeptide 7, cardiac muscle, beta
Alias beta-myosin heavy chain, beta-MHC, MHCb
GenBank/Locuslink ID 140781
Species Mm
Primer 1: Forward sequence 5'- AAGGGCCTGAATGAGGAGTAGATC -3'
Primer 2: Reverse sequence 5'- TGCAAAGGCTCCAGGTCTGA -3'
Spans Intron N
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Myh7 Myosin, heavy polypeptide 7, cardiac muscle, beta
Alias beta-myosin heavy chain, beta-MHC
GenBank/Locuslink ID 140781
Species Mm
Primer 1: Forward sequence 5'- GCATTCTCCTGCTGTTTCCTT -3'
Primer 2: Reverse sequence 5'- TGGATTCTCAAACGTGTCTAGTGA -3'
Probe Sequence 5'- CTCAGGTGGCTCCGAGAAAGGAAGC -3'
Product Size 355
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Vinciane Gaussin
Institution University of Medicine and Dentistry of New Jersey and New Jersey Medical School
PubMed ID 14623810
Citation Circulation. 2003 Dec 9;108(23):2926-33
Myh7 myosin, heavy polypeptide 7, cardiac muscle, beta
Alias beta-myosin heavy chain, beta-MHC, MHCb
GenBank/Locuslink ID X15939
Species Rn
Primer 1: Forward sequence 5'- AAGTCCTCCCTCAAGCTCCTAAGT -3'
Primer 2: Reverse sequence 5'- TTGCTTTGCCTTTGCCC -3'
Probe Sequence 5'- CATCAGCICCAGCATAGTTGGCAAACA -3'
Product Size 85
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Christophe Depre
Institution University of Texas Houston Medical School
PubMed ID 9809550
Citation NATURE MEDICINE : Vol.4 : No.11 : Nov.1998: 1269-1275
Myl4 Myosin, light polypeptide 4, alkali; atrial, embryonic
GenBank/Locuslink ID 17896
Alias myosin light chain, alkali, cardiac atria, MLC1A
Species Mm
Primer 1: Forward sequence 5'- GCATGTCCTTGCTACCCTGG -3'
Primer 2: Reverse sequence 5'- AAAGGCTTCATAGTTGATGCAGC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Myl7 Myosin, light polypeptide 7, regulatory
GenBank/Locuslink ID 17898
Alias myosin light chain, regulatory A, MLC2A
Species Mm
Primer 1: Forward sequence 5'- TCAAGGAAGCCTTCAGCTGC -3'
Primer 2: Reverse sequence 5'- CGGAACACTTACCCTCCCG -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
Nkx2-5 NK2 transcription factor related, locus 5
GenBank/Locuslink ID 18091
Species Mm
Primer 1: Forward sequence 5'- TGACCCAGCCAAAGACCCT -3'
Primer 2: Reverse sequence 5'- CCATCCGTCTCGGCTTTGT -3'
Probe Sequence 5'- AAAGAGCTGTGCGCGCTGCAGA -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Nppa natriuretic peptide precursor A
Alias Atrial natriuretic factor, ANF
GenBank/Locuslink ID 18157
Species Mm
Primer 1: Forward sequence 5'- CCATATTGGAGCAAATCCTGTG -3'
Primer 2: Reverse sequence 5'- CGGCATCTTCTCCTCCAGGT -3'
Spans Intron Y (short)
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Nppa natriuretic peptide precursor A
Alias Atrial natriuretic factor, ANF
GenBank/Locuslink ID 18157
Species Mm
Primer 1: Forward sequence 5'- GGCCATATTGGAGCAAATCCTGTG -3'
Primer 2: Reverse sequence 5'- CATGACCTCATCTTCTACCGGCAT -3'
Probe Sequence 5'- AGTGCGGTGTCCAACACAGATCTGAT -3'
Spans Intron Y (short)
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Nppb Natriuretic peptide precursor type B
Alias Brain natriuretic peptide, BNP
GenBank/Locuslink ID 18158
Species Mm
Primer 1: Forward sequence 5'- TGGGAAGTCCTAGCCAGTCTC -3'
Primer 2: Reverse sequence 5'- CTGTCTCTGGGCCATTTCCT -3'
Spans Intron Y (short)
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Nppb Natriuretic peptide precursor type B
Alias Brain natriuretic peptide, BMP
GenBank/Locuslink ID 18158
Species Mm
Primer 1: Forward sequence 5'- CCAGTCTCCAGAGCAATTCAAGAT -3'
Primer 2: Reverse sequence 5'- GCTAATTCACAAAGGACTCGAGGT -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
OXCT 3-oxoacid CoA transferase precursor
Alias Succinyl CoA:3-oxoacid CoA transferase, SCOT
GenBank/Locuslink ID U62961/5019
Species Hs
Primer 1: Forward sequence 5'- TGCCATTGCCAGTAAGCCA -3'
Primer 2: Reverse sequence 5'- TCCTCCAAAATAAAGTGCTGACC -3'
Probe Sequence 5'- AGGTGAGGGAGTTCAA -3'
Product Size 63
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
TBX5 T-box 5
GenBank ID AF221714
Species Hs
Primer 1: Forward sequence 5'- GCTGGAAGGCGGATGTTTC -3'
Primer 2: Reverse sequence 5'- TCGTTTTGGGATTAATGCCC -3'
Probe Sequence 5'- CAGTTACAAAGTGAAGGTGA -3'
Product Size 61
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
TGFb3 transforming growth factor, beta 3
GenBank/Locuslink ID X71903
Species Rn
Primer 1: Forward sequence 5'- CCCTTACCTCCGCAGCTC -3'
Primer 2: Reverse sequence 5'- CCGGGTTCAGGGTGTTGT -3'
Probe Sequence 5'- AACCCACAGCACGGTGCTTGGA -3'
Product Size 429
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Christophe Depre
Institution University of Texas Houston Medical School
PubMed ID 9809550
Citation NATURE MEDICINE : Vol.4 : No.11 : Nov.1998: 1269-1275

Downloadable Datasets Animal Models Project 1 Home

Page last modified: 17-Feb-2004


Affiliated Institutions | Sponsored by the National Heart, Lung, and Blood Institute
Copyright 2001-2003, CardioGenomics | Designed by Xpogen | Designed by Digizyme