Quantitative PCR Database

ABCD4 ATP-binding cassette, sub-family D (ALD), member 4
GenBank/Locuslink ID 19300
Species Mm
Primer 1: Forward sequence 5'- CCTTGAGAAGTTCACTCCTGGG -3'
Primer 2: Reverse sequence 5'- TCCGCTGCTCAGATGAACC -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method Two-step RT-PCR
PCR Program
Applied Biosynthesis 1 Step Mastermix
Stage I 30 min 48°C
Stage II 10 min 95°C
Stage III (40 cycles) 15 sec 95°C
1 min 60°C
Investigator Xiao-Song Zhao
Institution University of Texas Southwestern Medical Center
PubMed ID 12502795
Citation Physiol Genomics. 2002 Dec 26;12(1):53-60
ACTa1 actin, alpha 1, skeletal muscle
GenBank/Locuslink ID 11459
Species Mm
Primer 1: Forward sequence 5'- tatgtggctatccaggcggtg -3'
Primer 2: Reverse sequence 5'- cccagaatccaacacgatgc -3'
Spans Intron Y
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
AE-BP1 AE binding protein 1
GenBank ID AF053944
Species Hs
Primer 1: Forward sequence 5'- CATCACCCAGGGCAGAGACT -3'
Primer 2: Reverse sequence 5'- TTGCTGAAGCCCACGAAGA -3'
Probe Sequence 5'- AGCATCCATGACGATTTTGTGACCACC -3'
Product Size 69
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
ANF natriuretic peptide precursor type A
GenBank/Locuslink ID 18157
Species Mm
Primer 1: Forward sequence 5'- ccatattggagcaaatcctgtg -3'
Primer 2: Reverse sequence 5'- cggcatcttctcctccaggt -3'
Spans Intron Y (short)
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
ANF natriuretic peptide precursor type A
GenBank/Locuslink ID 18157
Species Mm
Primer 1: Forward sequence 5'- ggccatattggagcaaatcctgtg -3'
Primer 2: Reverse sequence 5'- catgacctcatcttctaccggcat -3'
Probe Sequence 5'- agtgcggtgtccaacacagatctgat -3'
Spans Intron Y (short)
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
BMP4 bone morphogenetic protein 4
GenBank/Locuslink ID 12159
Species Mm
Primer 1: Forward sequence 5'- agggaaccgggcttgagta -3'
Primer 2: Reverse sequence 5'- ctccagatgttcttcgtgatgg -3'
Probe Sequence 5'- cagccgagccaacactgtgaggagtt -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
BNP bone morphogenetic protein 4
GenBank/Locuslink ID 12159
Species Mm
Primer 1: Forward sequence 5'- tgggaagtcctagccagtctc -3'
Primer 2: Reverse sequence 5'- ctgtctctgggccatttcct -3'
Spans Intron Y (short)
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
DPYSL4 dihydropyrimidinase-like 4
GenBank ID Y10976
Species Hs
Primer 1: Forward sequence 5'- TGGTCAAGGAGAAGGGTGTGA -3'
Primer 2: Reverse sequence 5'- TGGCACCGGTCCTTGTATG -3'
Probe Sequence 5'- CCTTCCTGGTCTTCATG -3'
Product Size 61
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
DSCR1 Down syndrome critical region gene 1
GenBank ID U85267
Species Hs
Primer 1: Forward sequence 5'- CCTGTGTGGCAAACAGTGATATC -3'
Primer 2: Reverse sequence 5'- GTCATACGTCCTAAAGAGGGACTCA -3'
Probe Sequence 5'- CAGCGAAAGTGAAACCAGGGCCAAAT -3'
Product Size 77
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
GATA4 GATA binding protein 4
GenBank/Locuslink ID 14463
Species Mm
Primer 1: Forward sequence 5'- ccctggaagacaccccaat -3'
Primer 2: Reverse sequence 5'- tggacatggccccacaat -3'
Probe Sequence 5'- tcgatatgtttgatgacttctcagaaggcagag -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
GATA6 GATA binding protein 6
GenBank/Locuslink ID 14465
Species Mm
Primer 1: Forward sequence 5'- agatgaatggcctcagcagg -3'
Primer 2: Reverse sequence 5'- caagccgccgtgatgaa -3'
Probe Sequence 5'- ctcatcaagccacagaagcgcgtg -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
MEF2C myocyte enhancer factor 2C
GenBank/Locuslink ID 17260
Species Mm
Primer 1: Forward sequence 5'- tcaagtacaccgagtacaacgagc -3'
Primer 2: Reverse sequence 5'- tctttcttgttcaatgcctcca -3'
Probe Sequence 5'- cacgagagccggacaaactcagacatt -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
MHCa myosin, heavy polypeptide 6, cardiac muscle, alpha
GenBank/Locuslink ID 17888
Species Mm
Primer 1: Forward sequence 5'- ccactgtggtgcctcgttc -3'
Primer 2: Reverse sequence 5'- gcgtccgtcattctgtcactc -3'
Spans Intron N
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
MHCb myosin, heavy polypeptide 7, cardiac muscle, beta
GenBank/Locuslink ID 140781
Species Mm
Primer 1: Forward sequence 5'- aagggcctgaatgaggagtagatc -3'
Primer 2: Reverse sequence 5'- tgcaaaggctccaggtctga -3'
Spans Intron N
Detection Chemistry SYBR Green
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
Nkx2-5 NK2 transcription factor related, locus 5
GenBank/Locuslink ID 18091
Species Mm
Primer 1: Forward sequence 5'- tgacccagccaaagaccct -3'
Primer 2: Reverse sequence 5'- ccatccgtctcggctttgt -3'
Probe Sequence 5'- aaagagctgtgcgcgctgcaga -3'
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator William Pu
Institution Children's Hospital Boston
Email wpu@enders.tch.harvard.edu
OXCT 3-oxoacid CoA transferase
GenBank ID U62961
Species Hs
Primer 1: Forward sequence 5'- TGCCATTGCCAGTAAGCCA -3'
Primer 2: Reverse sequence 5'- TCCTCCAAAATAAAGTGCTGACC -3'
Probe Sequence 5'- AGGTGAGGGAGTTCAA -3'
Product Size 63
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics
TBX5 T-box 5
GenBank ID AF221714
Species Hs
Primer 1: Forward sequence 5'- GCTGGAAGGCGGATGTTTC -3'
Primer 2: Reverse sequence 5'- TCGTTTTGGGATTAATGCCC -3'
Probe Sequence 5'- CAGTTACAAAGTGAAGGTGA -3'
Product Size 61
Spans Intron Y
Detection Chemistry Taqman [Hydrolysis Probes]
Method One-step RT-PCR
PCR Program
Qiagen Quantitect
Stage I 30 min 50°C
Stage II 15 min 95°C
Stage III (40 cycles) 15 sec 94°C
1 min 60°C
Investigator Jeffrey Brown
Institution Cardiogenomics

Downloadable Datasets Animal Models Project 1 Home

Page last modified: 29-Jun-2004



Affiliated Institutions | Sponsored by the National Heart, Lung, and Blood Institute
Copyright 2001-2003, CardioGenomics | Designed by Digizyme